Biology
Alternative Learning Activities
List of alternate learning activitiesYou can watch a webinar and write a brief reflection (1 page) on what you learned. You will need to provide proof that you attended as well. Since each webinar is slightly different in length you will be able to obtain 10 points for each 1hr webinar up to a max of 20 points.Webinar options:I. Food Issues Forum: Building Back Better in Food and Nutrition Policy. Please join the Academy and National Consumers League as we host the first event in the Food Issues Forum series. This webinar, taking place on Wednesday, February 24, from 2-3:30 p.m. (Eastern Time), will highlight food and nutrition policy in the Biden Administration and discuss food safety priorities in the 117th U.S. Congress. This event is complimentary and is CPEU-eligible. Link to RegisterII. The 2021 Harkin on Wellness (HOW) Symposium will take place virtually on Monday, March 8 and March 9, 9 a.m.2 p.m. CST. This year’s symposium will explore how food is medicine to our bodies, society, economy and environment. Food is Medicine solutions promote better wellbeing and lower health care costs, create resilient and sustainable practices, reduce health disparities, improve economic competitiveness and lead to greater national security. Register hereIII. Designing, Implementing and Presenting Research to be Reviewed by the 2025 Dietary Guidelines Advisory Committee. March 10 12-1PM. In this webinar, Federal staff will present NESR methodology and discuss how it corresponds to designing and implementing research studies and to reporting study findings. Key components of the systematic reviews, such as inclusion and exclusion criteria and the risk of bias assessment, will be highlighted. Register HereIV. Innovative Concepts in Nutrition Seminar 2021 April 10 8-12 (A few former NIU students will be presenting who are now completing their rotations at Ingles) Register HereV. Tammy Duckworth Townhall 3-4PM- I am going to see if there is a recording available.. Register Here
The immune system
Topic: The immune system is a daunting system to cover. However, it is critical for a healthcare professional to understand how the immune system works. This week you will provide a written response that analyzes the mechanism of action for the three lines of defense in the immune system.Assignment Expectations:You will write a 2000-2250 word essay, not including the Title and References pages (typed,12 point font, double spaced).In addition, I have included a link to research article (Item 10). You should read and provide a review of this article in item 10.Required Topics to Address:Physical barriers, the first line of defenseThe second line of defense, the innate immune systemPhagocytosisImmunological SurveillanceInterferonsInflammationThe third line of defense, humoral immunityAntibody structure and classesThe third line of defense, cell-mediated immunityVaccines and pseudoscience (review this article and provide a summary:http://www.miottawa.org/Health/OCHD/pdf/2007_Nature_DeStefano_Vaccines_and_Autism.pdf)References- Support your content with at least (5) citations. Make sure to reference the citations using APA writing style for the presentation.
Software Program
Required ResourcesRead/review the following resources for this activity:Textbook: Chapter 13LessonMinimum of 1 scholarly source (in addition to the textbookIntroductionSome people believe that you can tell who a person is by what they do when no one is looking. Let’s look at the following case. John Doe, a nurse, has downloaded an application to her phone that allows him to download copyrighted textbooks for a nursing course (that Doe is going to take) without his Internet Service Provider knowing it. The application is called “Cloak” as in cloak of invisibility (a hooded coat one wears to make it so others cannot see you). The application disguises his phone and makes it so the information on it is inaccessible. John is aware that other people who are of a lower socio-economic status (like him) also use this software program for the same reason (and to save money). John Doe knows that his religion forbids him from using this application to download in this manner. John Doe is focused on his own economic situation and does not consider the publisher, author, and others involved in the books. Think about a course of social action; what social values should be used to address this moral issue and conflict.Initial Post InstructionsCreate a personal ethical philosophy and explain from which philosophy or philosophies (it must include at least one of the following: virtue ethics, Kantian ethics, utilitarianism, virtue ethics, or social contract ethics) you created it and why the contents are important and meaningful for you. List its precepts.Take your personal ethical philosophy statement and use it to work through John Doe’s case. What is moral and immoral per your theory?How would the veil of ignorance or a different theory of justice address John Doe’s case?Follow-Up Post InstructionsRespond to at least one peer. When possible, respond to a peer who chose a different ethical theory than you did in your posting. Further the dialogue by providing more information and clarification.Writing RequirementsMinimum of 2 posts (1 initial & 1 follow-up)Minimum of 2 sources cited (assigned readings/online lessons and an outside scholarly source)APA format for in-text citations and list of references
The Chemistry of Digestion
The Chemistry of DigestionWhat is important to understand about the chemistry of digestion is that we consume macromolecules in our diet: proteins, carbohydrates, and fats or lipids; and through chemical digestion the substances are broken down into their simplest parts: amino acids, monosaccharides or simple sugars, and fatty acids. Enzymes, proteins that are used to catalyze these reactions are made by our bodies. It is amazing to witness, and in the test tube we can see the results of enzymes and their role in digestion.A lactose intolerant person, for example, simply fails to produce lactase. Lactase is the enzyme necessary to breakdown lactose. Maltase breaks down maltose, and sucrase breaks down sucrose.1. Name the test solution or the reagent use to test for the presence of the following, name the initial color, and the positive result indicator. You may list the information in a table form if you choose.StarchGlucoseProteinLipid2. What do you do if you get unexpected results, when doing this type of experimentation?
The Symbiotic Relationship
Important ideas to understand as you watch the video:1. Is the symbiotic relationship between the coral and the algae parasitic or mutualistic? Why do you think this? If you need help, use this resource.2. How does the temperature of the water impact the algae?3. Why are the coral reefs becoming the white or bleached color?4. Do you think Australia should approve the coal mining? Why or why not?5. Do you think that this thermal pollution is point or nonpoint source? Why or why not?
DNA Mutation Simulation
DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/
Impact of Gene Fusion
Topic: Discuss the pathological and prognostic impact of gene fusion in blood cancer.Key points:1- the normal function of gene before the fusion event2- the altered function of gene post fusion3-How the altered function of fused genes affects the disease progression/initiation4- How the altered function of fused genes affects the disease prognosis5- Text paraphrasing should be applied as the text will be scanned for text similarity6- Make a good use of referencing system of your choice8 the format of the text is: Abstract–> introduction–>body of the topic —> conclusion.9- Reference should include text books and papers.
Secrecy and Discretion
Hi, am Abell Arora independent high-profile model Escort in Chandigarh any time at any hotel like your location or mine location. Incall and outcall are both available. Full-service guarantee in your time no west money in fake agency call or WhatsApp Riya Kapoor. Treat you like your girlfriend. If you want to spend your time doing something else, a luxurious night with beautiful Chandigarh escorts is the best way to do it in Chandigarh. Since there are so many of them, it is good to know a bit about them before you select an escort. Make sure that you are comfortable with the person you select. Select someone who is willing to take the time to listen to your needs and wants. The hotels and motels in Chandigarh cannot be compared to the services that the Chandigarh escort services provide. Some of the escorts of Chandigarh who travel around offering their services often don’t even consider going to Chandigarh because they think it is a ‘blah’ place. What they don’t realize is that in Chandigarh, they can find just about anything. Being able to enjoy your time with the person of your fantasy also needs secrecy and discretion. Besides that, you do not want to be infected with something embarrassing. That is the reason Chandigarh Escorts sign up anon disclosure agreement with the Escort Service in Chandigarh and is only appointed after a complete background verification
Forensic Anthropology
Click here for a diagram of the human skeleton. For this portion of the assignment, you must fill in the correct anatomical names for each of the major bones in the body. On a document of 12 pages, provide brief descriptions of each of the identified bones.Part IIA forensic laboratory is responsible for examining any unidentified skeletal remains provided from a crime scene and trying to recreate the identity of a person by using those skeletal remains. One of the major structures used to identify victims from a crime that have left them unable to be recognized or unidentifiable is the skull. It is important to know that teeth are embedded in the skull and that muscles are attached to the skull.A forensic team was sent to a fire that occurred in a warehouse. Initially, the firemen said that the building was empty, but on the final walk-through of the building, they discovered what appeared to be burned human remains. The forensic team gathered all of the burned victims bones, tissue, and other pieces of clothing and took them to the laboratory for investigation.Assignment GuidelinesComplete Part I of the assignment.Address Part II in 34 pages:Explain in detail how the following will be used in facial reconstruction:OdontologyWhat is odontology?How is this process used in facial reconstruction?Bone formationWhat are the 3 primary cells that make up bone, and what is their function?What information can be obtained from the skeleton with regard to growth?How many bones are in the skull (face/head), and how are they important?MusclesWhat are the major muscles in the face, and what do they control?What can be learned about the identification of the person based on the muscles?
Facial Reconstruction
The bones of the face, or skull as it is sometimes referred to, are there for the purpose of protecting and supporting the entrance to the digestive system and the respiratory system. These bones also provide sites for the attachment of muscles that control the mouth, eyes, scalp, and lower jaw. The bones and muscles of the face and head are all needed by forensics teams to recreate what was once the face of an individual. This is known as facial reconstruction. The skull provides clues to the personal appearance. Facial reconstruction can put a name on an unidentified body in a modern forensic case.Address the following in your main post:Why do you think facial reconstruction is important to a crime scene? Explain.What do you think are the most significant challenges associated with facial reconstruction? Explain.What is the most important historical contribution to the study of facial reconstruction? Why?What role do you think technology has played in improving facial reconstruction techniques? Provide an example to support your argument.
Use Promo Code: FIRST15