DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

Struggling to find relevant content? Order a custom essay on
DNA Mutation Simulation
Let our experts save you the hassle
Order Now
Calculate the price
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know how difficult it is to be a student these days. That's why our prices are one of the most affordable on the market, and there are no hidden fees.

Instead, we offer bonuses, discounts, and free services to make your experience outstanding.
Sign up, place your order, and leave the rest to our professional paper writers in less than 2 minutes.
step 1
Upload assignment instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
s
Get personalized services with GPA Fix
One writer for all your papers
You can select one writer for all your papers. This option enhances the consistency in the quality of your assignments. Select your preferred writer from the list of writers who have handledf your previous assignments
Same paper from different writers
Are you ordering the same assignment for a friend? You can get the same paper from different writers. The goal is to produce 100% unique and original papers
Copy of sources used
Our homework writers will provide you with copies of sources used on your request. Just add the option when plaing your order
What our partners say about us
We appreciate every review and are always looking for ways to grow. See what other students think about our do my paper service.
English 101
The paper was late. However, it was excellent quality.
Customer 452561, July 2nd, 2021
Social Work and Human Services
Excellent Work!
Customer 452587, August 24th, 2021
Nursing
Amazing as always!!! :)
Customer 452453, March 16th, 2023
Human Resources Management (HRM)
Thank you so much for your time.
Customer 452701, September 5th, 2023
Eng 099
I recveived a B on this paper but I'm not sure why.
Customer 452775, June 18th, 2022
Social Work and Human Services
Awesome Work!
Customer 452587, October 20th, 2021
Human Resources Management (HRM)
Excellent
Customer 452813, December 30th, 2023
Technology
i would like if they would attach the turnin report with paper
Customer 452901, August 17th, 2023
Business and administrative studies
GOOD
Customer 452813, June 30th, 2022
Other
Great work! Thank so much!
Customer 452707, March 1st, 2022
Nursing
Thank you!!!
Customer 452557, June 26th, 2021
Other
GOOD
Customer 452813, July 5th, 2022
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat

Good News ! We now help with PROCTORED EXAM. Chat with a support agent for more information