DNA in our genes

Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells   2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.  3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf   1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc   2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Struggling to find relevant content? Order a custom essay on
DNA in our genes
Let our experts save you the hassle
Order Now
Calculate the price
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know how difficult it is to be a student these days. That's why our prices are one of the most affordable on the market, and there are no hidden fees.

Instead, we offer bonuses, discounts, and free services to make your experience outstanding.
Sign up, place your order, and leave the rest to our professional paper writers in less than 2 minutes.
step 1
Upload assignment instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
s
Get personalized services with GPA Fix
One writer for all your papers
You can select one writer for all your papers. This option enhances the consistency in the quality of your assignments. Select your preferred writer from the list of writers who have handledf your previous assignments
Same paper from different writers
Are you ordering the same assignment for a friend? You can get the same paper from different writers. The goal is to produce 100% unique and original papers
Copy of sources used
Our homework writers will provide you with copies of sources used on your request. Just add the option when plaing your order
What our partners say about us
We appreciate every review and are always looking for ways to grow. See what other students think about our do my paper service.
Literature
Excellent
Customer 452813, July 5th, 2023
Other
GREAT
Customer 452813, June 20th, 2022
Nursing
Perfect as usual!!! Thanks team!
Customer 452453, May 26th, 2021
Professions and Applied Sciences
Thank you!
Customer 452707, March 4th, 2022
Political science
THANK YOU
Customer 453001, April 25th, 2024
nursing
Thank you!
Customer 452707, April 2nd, 2022
Nursing
Fantastic work on this project as usual.
Customer 452707, July 5th, 2022
Social Work and Human Services
Excellent Work!
Customer 452587, July 28th, 2021
Professions and Applied Sciences
Amazing work!
Customer 452707, May 29th, 2022
Accounting
Thanks for your support
Customer 452701, February 3rd, 2022
Other
GOOD
Customer 452813, July 10th, 2022
Human Resources Management (HRM)
Thanks for the paper. Hopefully this one will receive higher than a C and has followed all guidelines.
Customer 452701, November 16th, 2022
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat

Good News ! We now help with PROCTORED EXAM. Chat with a support agent for more information