Biological Approaches

Each answer can be 1200 words long but no longer, References are not included in this word count. ,1.5 line spacing, justified layout and 11pt Arial font and indicate the word count per question. Two essay question need to be answered nicely structured, clear and no plagiarism. Please cite intent citations if needed and references on the bottom of questions if needed as well. Book: Physiology of Behavior (for any info)

Read more

An elective Atherosclerosis

The essay should contain 1200 in a word format about the molecular mechanisms of Atherosclerosis. I suggest to start with general explanation of the etiology and pathogenesis of the disease but the bulk of the essay has to contain the information from the document which I’m not uploadingThe article would require a biochemist or a molecular biologist to understand thoughsee attached

Read more

Cardiac Muscle Cells

Why would cardiac muscle cells and some smooth muscle cells continue to contract even when their nerve supply has been removed or severed?

Read more

Muscle Fibers

Compare and contrast the types of muscle fibers. How do the contractions and energy sources of each differ?

Read more

components of blood

1. what are the bloods main function? give 5 specific examples with detailed explanation. 2. what are the main components of blood? give 3 specific examples with a detailed explanation of their role and purpose. Address each question in a single essay style document with each topic separated with the APA level heading and include a conclusion paragraph. APA format, Times new Roman, 12 font, double-spaced, 900 words minimum

Read more

DNA in our genes

Rewrite Please 1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells   2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.  3. Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. Link for Chapter 15: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf   1. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc   2. aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Read more

the field of metagenomics

hapter 17 discusses trends in biotechnology and the field of metagenomics. For your discussion post: Chapter 17 Link: https://my.uopeople.edu/pluginfile.php/1015434/mod_page/content/6/BIOL1121-Textbook-Ch11_Ch20.pdf 1. Explain why metagenomics is probably the most revolutionary application of genomics. What application of genomics would best serve your community and why? 2. Research?Bioremediation?as an application of metagenomics, and comment on how this mechanism can be utilized as an environmental management intervention within your community. Here are some videos to get you started: 1. Can microbes clean up our oily mess? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_mu9e5u96/embed/thumb? 2.  Researchers could use microbes to clean up mine sites? Video Link: https://www.kaltura.com/index.php/extwidget/preview/partner_id/1934481/uiconf_id/45150521/entry_id/0_k9wqzuj5/embed/thumb?

Read more

Inequity

In 500 words or less, discuss an issue of personal, local, national, or international inequality and why it matters to you. MAXIMUM 500 WORDS. ATLEAST 450 WORDS.

Read more

Population of Organisms

1. What is the common name and the scientific name of your species?2. What is your species’ Redlist category? (For example, endangered, critically endangered, or one of the others.)3. What kind of habitat does the species inhabit? Briefly describe the habitat/biome.a. Tell what other plants and animals live in this biome.4. What are some of the threats to the species?a. Which threats are caused by humans?5. Does human population growth adversely impact this species? In what way?6. Consider the population of your species.a. What is the estimated population of the organism and how was it measured?b. What is the population trend?7. Consider the habitat for your species.a. What might be some density dependent factors?b. What might be some density independent factors?c. Briefly list ways in which climate change might be affecting this creature’s habitat.d. List two actions people can do to preserve this species and biodiversity.8. List some things that can be done to protect this species’ habitat.9. Is your species in an extinction vortex? Explain.

Read more

A Keystone Species

Discuss what it means for a species to be a keystone species, and give an example.a. Is the species you picked on the Redlist a keystone species? Why, or why not?11. If your species becomes extinct, what changes might you expect to occur in its biome and the food web?a. Which species might benefit if your species becomes extinct, and why would that/those species benefit?b. Which species would be harmed if your species becomes extinct?c. Comment on possible interaction of these on your species:i. Mutualism (page 352 in your textbook)ii. Predation (page 352 in your textbook)iii. Competition (page 353 in your textbook)

Read more
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat

Good News ! We now help with PROCTORED EXAM. Chat with a support agent for more information