Biology

When writing your paper watch your verb tense. You are reporting on something you have read, so the past tense is usually most appropriate. Your paper must be typed, double-spaced, and at least 2 to 3 pages in length. (THIS DOESN’t INCLUDE YOUR COVER PAGE OR REFERENCE PAGE.) Failing to meet the minimum requirements for length will reduce your score by 10 points. You are to have a 1 inch margin on all sides. You must use a 12-pitch font.

A.    Name in every page (header) B.    Reference (cite all papers, books, magazines, ebooks, websites you choose) in APA format. ·       write abouy How Global warming affect planet’s life….and make a personal comment about the article you choose  article/articles about  ·       Format the project must be in Arial 11 pts typed with 1.5 line spacing.

****************POWERPOINT 11 SLIDES (ADJUST PRICE)**************** Instructions Human Impact on Climate Change PowerPoint After learning about several ways in which our everyday actions impact climate change, choose one action to conduct more research on and create a PowerPoint presentation to tell us more! Use the unit material and reliable online resources to gather more information. There are several ideas with information throughout the unit but there is even more information out in the world! Think about what you do every day, and how the activity uses energy or natural resources. Think about a product you buy—how it was made, what natural resources were used to make it? You can also do a quick google search of “everyday activities that effect the environment” and start reading some articles for more ideas. Remember to use reliable sources from the Internet. There is a lot of misinformation out there and finding reliable information can be difficult. The best sources of reference material for your presentation are scientific journals found in the CSU Online Library databases. Click here for a biology research tutorial that demonstrates how to locate library resources relating to biology You can also find reliable statistics at organization websites listed in the Unit under “Combat Climate Change.” Your presentation must include: What everyday activity or product have you chosen to present? Why did you choose this activity or product? Why is it important? Connect the activity/product to its impact on the environment and climate change. How does doing the activity or making the product use natural resources, disrupt habitat, impact wildlife or other effects on the environment? Report data and statistics, with references, on how this activity/product effects the environment. What can people do to decrease the activity/product’s impact on the environment? Be sure to follow the formatting and guidelines provided below: Include at least three visual aids. Include three reliable references, and at least one source must come from the CSU Online Library. Use bulleted information on slides (five lines or fewer). Include substantial and detailed speaker’s notes that include what you would say in an actual presentation. The speaker’s notes should also reflect the depth of your research. Include a separate title slide and separate reference slide. Use an appropriate font and background. Include at least 11 slides, but not more than 15 slides (not counting your title slide and reference slide). Use correct APA format for references and citations, and use correct grammar and spelling. Upload the presentation as a .ppt or .pptx file.

We are writing a book chapter on dental stem cells and tissue engineering and I need help writing some sections. The sections are listed below. I want 2.5 pages devoted to each section of this titles so they can add up to 8 pages.  Stem cells for craniofacial tissue engineering ? Mesenchymal stem cells  ? Bone marrow-derived MSCs ? Adipose-derived MSCs for all these three topics I want to explain each and then talk about  how they can be used in craniofacial tissue engineering The most important think is that I want all the articles/ journals/ papers that are used have an impact factor above 7.

Write a 750-1,000-word essay about water quality in your community that addresses the following points: Obtain a water quality report from your local municipality within the last two years and discuss what you found in the report? Identify a water quality issue happening in your community and where the pollution comes from? This includes point sources (for example, water discharge from a factory; contamination from a Superfund site), Non-point sources (for example, agricultural runoff), and Natural sources. Describe how the pollution source is impacting the environment and human health in your community, and provide two examples of each. Identify three management practices to minimize water pollution. Remember to support your data and information with appropriate citations. A minimum of five peer-reviewed references must be included.

Consider at least three seafood items that you, members of your family, or perhaps your friends commonly eat that appear on the Seafood Watch guides. What are they? Are they “best choices”, “good alternatives”, or ones to “avoid”? Which ones fall into more than one category and why based on your understanding of the classifications? Choose the national guide: https://www.seafoodwatch.org/seafood-recommendations/consumer-guides [Note: If you, your family and friends do not eat seafood, pretend that you do and respond to the question accordingly.] Your response should be at least 75 words in length.

Your paper should serve as a synthesis of what is currently known about your topic, and what is being investigated. Do not simply summarize each of your primary sources; rather, integrate the information presented, and come up with your own interpretation of the data. If the data on your topic is controversial (i.e. some articles support one view, while others take a different stance), you must address both arguments. -Use 12pt font (Times New Roman or Garamond ONLY), 1-inch margins. -Must include 10 references. Of the 10 references, at least 7 must be primary research papers, and up to 3 can be review papers. -The papers you select must be published within the last 10 years.

TextBook Resource lark, M.A., Choi, J. & Douglas, M. (2020, Jan 18). Biology 2e. Open Stax. Available online https://openstax.org/books/biology-2e/pages/preface  or for PDF download at the following links: Chapters 1-10 Chapters 11-20 Chapters 21-29 Chapters 30-38 Chapters 39-47 Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.  Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells  Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.  Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.   aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc   aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Most community action plans can benefit from recruiting partners—individuals or organizations that might help with the solution to the public health issue. These partners may have money, special tools or skills, and other resources. Create a list of at least ten local partners/stakeholders who might be willing to help you implement or develop your own community action plan. Remember, a stakeholder is a person with an interest or concern in something. For each potential partner, include: the potential partner’s name, comprehensive contact information (job title, address, phone, website, and any assistants’ names), a short explanation of why you think the partner or stakeholder would be useful to your project, and why you think that particular partner might be interested in joining your effort—that is, what is the benefit to the partner in doing so? Your partners could come from the following (don’t be limited by this list): Government officials (state, regional, local, or federal) Local health/public health department agent(s) Non-profits or non-governmental organizations (NGOs). Think broadly. For example, consider national and local organizations (e.g., men and women’s organizations, schools, government-funded services, and volunteer organizations). Businesses often help fund or implement community projects. Colleges or universities may have grants, special departments, or clubs/organizations. Churches or faith-based organizations Instructions: Write a well-organized list that is a 2-3-page paper, not including the title and reference pages, which are required. The paper must be formatted correctly using APA style. Remember, all research material used in your paper must be paraphrased and include an in-text citation. This is an individual paper; however, you should reflect on our Discussion Forums and incorporate ideas from there, as appropriate. Be sure you utilize your text appropriately as a reference and cite at least one other credible external reference such as a website or journal article to support your proposed resolution of the case. Your external sources can be trade publications  (Links to an external site.) , government information, newspaper articles, or scholarly or peer-reviewed  (Links to an external site.)  journal articles.

sources must be within the last 6 years need introduction and conclusions  Write an essay describing a disease found in the Reproductive System  (100 points) Using medical terminology identify the name that the physician would list as the diagnosis. Describe the illness or injury. Identify the location (Based on what you learned in Chapter 2). Describe symptoms. Describe possible treatments. Create a table with all medical terms used and break the words down. For all medical terms give an explanation in layman’s terms you would use to explain to the patient.